ID: 1132081784_1132081787

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1132081784 1132081787
Species Human (GRCh38) Human (GRCh38)
Location 15:98872129-98872151 15:98872151-98872173
Sequence CCATGTCCAACCTGCACTAAATG GAAGATTATTTTCGAGCGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131} {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!