ID: 1132090785_1132090791

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1132090785 1132090791
Species Human (GRCh38) Human (GRCh38)
Location 15:98946600-98946622 15:98946622-98946644
Sequence CCAAGGGCATGGGTGACAGCAGG GCAGACTGCTCGGGTGGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 349} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!