ID: 1132097073_1132097076

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1132097073 1132097076
Species Human (GRCh38) Human (GRCh38)
Location 15:98994670-98994692 15:98994701-98994723
Sequence CCCTCCTTGCATTTCACACTGTC ATCATTTTCCTTCCTTTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 310} {0: 1, 1: 0, 2: 10, 3: 111, 4: 1307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!