ID: 1132210367_1132210384

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132210367 1132210384
Species Human (GRCh38) Human (GRCh38)
Location 15:100017429-100017451 15:100017480-100017502
Sequence CCTTCTCCCTGTGGTGTTCAGCC CCTGTGGTGCCAGGCAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 452} {0: 137, 1: 146, 2: 97, 3: 112, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!