ID: 1132248805_1132248813

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1132248805 1132248813
Species Human (GRCh38) Human (GRCh38)
Location 15:100318024-100318046 15:100318045-100318067
Sequence CCTGCCATTACAAAGCCCCAGGG GGACATTTGCAGGACATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 138} {0: 1, 1: 0, 2: 1, 3: 36, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!