ID: 1132309865_1132309874

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132309865 1132309874
Species Human (GRCh38) Human (GRCh38)
Location 15:100849667-100849689 15:100849701-100849723
Sequence CCCCCCTGGACGTACAGAACCAG GCTCCACACAGGCCACCGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 204} {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!