ID: 1132326684_1132326687

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1132326684 1132326687
Species Human (GRCh38) Human (GRCh38)
Location 15:100976181-100976203 15:100976200-100976222
Sequence CCTTCTGACAAAGCAAATTCTAG CTAGGTCTACATGGTTTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 218} {0: 1, 1: 0, 2: 4, 3: 39, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!