ID: 1132398447_1132398463

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1132398447 1132398463
Species Human (GRCh38) Human (GRCh38)
Location 15:101490259-101490281 15:101490303-101490325
Sequence CCGAGAAACCACCGCACGGAGCC TGCTGGGAGGCAGGCCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 207} {0: 1, 1: 0, 2: 5, 3: 45, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!