ID: 1132432402_1132432410

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132432402 1132432410
Species Human (GRCh38) Human (GRCh38)
Location 15:101772458-101772480 15:101772491-101772513
Sequence CCTCCAGGAGGTCCATAAGGCCA AAAATAATGGGTTCACATCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 4, 3: 22, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!