ID: 1132462046_1132462059

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132462046 1132462059
Species Human (GRCh38) Human (GRCh38)
Location 16:60363-60385 16:60387-60409
Sequence CCCTACACCCTCTGCACCACAGC CCCGGGGAAGGTGTGGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 250} {0: 1, 1: 0, 2: 1, 3: 11, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!