ID: 1132462092_1132462105

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132462092 1132462105
Species Human (GRCh38) Human (GRCh38)
Location 16:60530-60552 16:60577-60599
Sequence CCAGCGTGGACTGTGGGAGGGGG CAGGGCAATGAGGGGCACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 288} {0: 1, 1: 0, 2: 0, 3: 18, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!