ID: 1132497515_1132497524

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1132497515 1132497524
Species Human (GRCh38) Human (GRCh38)
Location 16:270861-270883 16:270880-270902
Sequence CCATCGAGAGTGGCAGCCAGGGC GGGCCGGTGGGGGGTTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 171} {0: 1, 1: 0, 2: 1, 3: 23, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!