ID: 1132543179_1132543192

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1132543179 1132543192
Species Human (GRCh38) Human (GRCh38)
Location 16:520984-521006 16:521013-521035
Sequence CCGCCAAAGACCGGGGCTGCCAA AGAGGGTGGTGGAGAGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85} {0: 2, 1: 2, 2: 28, 3: 248, 4: 2164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!