ID: 1132547854_1132547863

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1132547854 1132547863
Species Human (GRCh38) Human (GRCh38)
Location 16:541417-541439 16:541437-541459
Sequence CCCTGATGGACAGAGAGACGCGG CGGCAAAGGCAGGGCCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100} {0: 1, 1: 1, 2: 4, 3: 31, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!