ID: 1132548944_1132548954

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132548944 1132548954
Species Human (GRCh38) Human (GRCh38)
Location 16:546454-546476 16:546488-546510
Sequence CCAGGACGACCTGGTCCTGAGTT CCCTGCTATCTGCCGTCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 86} {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!