ID: 1132550271_1132550276

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1132550271 1132550276
Species Human (GRCh38) Human (GRCh38)
Location 16:551188-551210 16:551203-551225
Sequence CCCGGTCGGTGAGGGTCCCCAGT TCCCCAGTCGGTGAGGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 8, 3: 15, 4: 113} {0: 1, 1: 2, 2: 6, 3: 15, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!