ID: 1132555837_1132555845

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1132555837 1132555845
Species Human (GRCh38) Human (GRCh38)
Location 16:572286-572308 16:572305-572327
Sequence CCGCCTGCCCTCTCTGACCACTG ACTGAGGAAATGGGCATTTGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 50, 4: 564} {0: 1, 1: 0, 2: 2, 3: 36, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!