ID: 1132566995_1132567000

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1132566995 1132567000
Species Human (GRCh38) Human (GRCh38)
Location 16:628119-628141 16:628137-628159
Sequence CCAGAGGCCGGGGGAGCAGACAG GACAGGGCCGGTGCTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 383} {0: 1, 1: 0, 2: 2, 3: 9, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!