ID: 1132567001_1132567021

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1132567001 1132567021
Species Human (GRCh38) Human (GRCh38)
Location 16:628144-628166 16:628192-628214
Sequence CCGGTGCTCCCTCTGGAAGCTTG GGATGGAGGGTGTGGTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 302} {0: 1, 1: 2, 2: 5, 3: 52, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!