ID: 1132590994_1132590999

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132590994 1132590999
Species Human (GRCh38) Human (GRCh38)
Location 16:726422-726444 16:726446-726468
Sequence CCCCATGGCTGCTGCTGCCACTG CACTGCTAAGTGCGTTGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 524} {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!