ID: 1132593541_1132593555

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132593541 1132593555
Species Human (GRCh38) Human (GRCh38)
Location 16:737608-737630 16:737642-737664
Sequence CCCCACTCACCCATGGGGCCCTG GGCCCCGGTGCACACTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 268} {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!