ID: 1132618759_1132618775

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132618759 1132618775
Species Human (GRCh38) Human (GRCh38)
Location 16:854728-854750 16:854779-854801
Sequence CCCAGGGCCTGCTGGGACTCCCG CTGAGCTGCAGCTGCTCACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 27, 4: 283} {0: 1, 1: 0, 2: 2, 3: 31, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!