ID: 1132686251_1132686263

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1132686251 1132686263
Species Human (GRCh38) Human (GRCh38)
Location 16:1163332-1163354 16:1163374-1163396
Sequence CCGGGGTACGGTGTGGAGCTACG GTGCTCCCGGGAGGGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24} {0: 1, 1: 1, 2: 1, 3: 29, 4: 620}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!