ID: 1132712676_1132712682

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132712676 1132712682
Species Human (GRCh38) Human (GRCh38)
Location 16:1276479-1276501 16:1276506-1276528
Sequence CCAGGTCATTCTCGGGGACGGGA GGAACAACAGAAGGAGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!