ID: 1132729625_1132729631

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1132729625 1132729631
Species Human (GRCh38) Human (GRCh38)
Location 16:1355027-1355049 16:1355054-1355076
Sequence CCGCATGTGCGGGGTCGGGTGTG GTCTGCCGCGTCTGCGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 57} {0: 1, 1: 1, 2: 3, 3: 15, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!