ID: 1132738145_1132738151

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1132738145 1132738151
Species Human (GRCh38) Human (GRCh38)
Location 16:1397526-1397548 16:1397539-1397561
Sequence CCCGTGCTTCACGCTGGGGCAGG CTGGGGCAGGGCATGGACCTGGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 17, 4: 162} {0: 2, 1: 5, 2: 8, 3: 64, 4: 664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!