ID: 1132748485_1132748496

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1132748485 1132748496
Species Human (GRCh38) Human (GRCh38)
Location 16:1446767-1446789 16:1446793-1446815
Sequence CCTGTGGAGCTCCCTGCCTTGTG GGCTGGGGCAGCACAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 251} {0: 1, 1: 1, 2: 12, 3: 111, 4: 984}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!