ID: 1132754249_1132754260

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132754249 1132754260
Species Human (GRCh38) Human (GRCh38)
Location 16:1474936-1474958 16:1474979-1475001
Sequence CCGGCCGGACCAGGACACCTTCT CGCCGCGGAGCGACACCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!