ID: 1132760631_1132760642

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1132760631 1132760642
Species Human (GRCh38) Human (GRCh38)
Location 16:1507070-1507092 16:1507115-1507137
Sequence CCGGGCGCCGGCCTGTGCTAACC CCTCACCTGCGCCCAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65} {0: 1, 1: 0, 2: 1, 3: 31, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!