ID: 1132765524_1132765531

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1132765524 1132765531
Species Human (GRCh38) Human (GRCh38)
Location 16:1532453-1532475 16:1532499-1532521
Sequence CCTTGCTTCACCTGTGGATATAC TGGAGACTGGTCCCAGGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131} {0: 1, 1: 0, 2: 2, 3: 28, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!