ID: 1132774681_1132774685

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132774681 1132774685
Species Human (GRCh38) Human (GRCh38)
Location 16:1586454-1586476 16:1586487-1586509
Sequence CCAGTGCGGGGGTGGTGGGGGAT CAGCTTTCCTAGAGGCCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 285} {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!