ID: 1132779330_1132779355

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1132779330 1132779355
Species Human (GRCh38) Human (GRCh38)
Location 16:1614276-1614298 16:1614313-1614335
Sequence CCCAGACCCGCGCCCGCGCCGGG CGGGGCCGGGGCCGGGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256} {0: 79, 1: 138, 2: 262, 3: 934, 4: 3910}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!