ID: 1132811718_1132811722

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132811718 1132811722
Species Human (GRCh38) Human (GRCh38)
Location 16:1802491-1802513 16:1802523-1802545
Sequence CCTAACCCAAGATGACAGAGATG AGCTGCTTCTGAAAGTCTGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 74, 4: 559} {0: 1, 1: 0, 2: 1, 3: 18, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!