ID: 1132812748_1132812763

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1132812748 1132812763
Species Human (GRCh38) Human (GRCh38)
Location 16:1809438-1809460 16:1809488-1809510
Sequence CCAGGGCCACTGCAGAGGAAGGC AGAGGACACGGAGGGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 326} {0: 1, 1: 0, 2: 1, 3: 48, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!