ID: 1132845381_1132845389

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1132845381 1132845389
Species Human (GRCh38) Human (GRCh38)
Location 16:1998827-1998849 16:1998845-1998867
Sequence CCCGTGGGGCAGGCAGCAGCCTG GCCTGGGTCTGGGGGTCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 418} {0: 1, 1: 0, 2: 4, 3: 73, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!