ID: 1132846217_1132846229

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1132846217 1132846229
Species Human (GRCh38) Human (GRCh38)
Location 16:2002037-2002059 16:2002080-2002102
Sequence CCTGAGGGAGCAAGAGCTCCTGG GCTCCAGCCTGGCCGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 332} {0: 1, 1: 0, 2: 0, 3: 37, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!