ID: 1132862196_1132862208

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1132862196 1132862208
Species Human (GRCh38) Human (GRCh38)
Location 16:2077205-2077227 16:2077246-2077268
Sequence CCACTGAGGCCTCAGTGCCGCCT GCCTGCCTTCCGCGGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 255} {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!