ID: 1132884894_1132884914

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132884894 1132884914
Species Human (GRCh38) Human (GRCh38)
Location 16:2178342-2178364 16:2178393-2178415
Sequence CCGCGGGCGCAGGGTCTGCCTAG CCCGGTGGGCGCCCCGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 103} {0: 1, 1: 0, 2: 3, 3: 45, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!