ID: 1132896343_1132896353

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1132896343 1132896353
Species Human (GRCh38) Human (GRCh38)
Location 16:2231039-2231061 16:2231078-2231100
Sequence CCCCTTTGCGGGCATCCTGGGTA GGCCAGTCAGCAGGCCCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59} {0: 1, 1: 0, 2: 1, 3: 7, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!