ID: 1132897536_1132897545

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1132897536 1132897545
Species Human (GRCh38) Human (GRCh38)
Location 16:2236198-2236220 16:2236222-2236244
Sequence CCGGGATGTGGCTGACCGTCTAC TCCCTCCTAGGGGGCTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 1, 3: 23, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!