ID: 1132905897_1132905912

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1132905897 1132905912
Species Human (GRCh38) Human (GRCh38)
Location 16:2282765-2282787 16:2282813-2282835
Sequence CCCTGGGCACCACCTCTGCTCAG CATCCCCTCCTCCGGGCACTGGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 3, 3: 28, 4: 316} {0: 4, 1: 1, 2: 0, 3: 26, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!