ID: 1132920316_1132920325

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1132920316 1132920325
Species Human (GRCh38) Human (GRCh38)
Location 16:2386196-2386218 16:2386243-2386265
Sequence CCTGAGCGGGGGCATGAGCCGCA TCGCAGGCTCCAAGGTGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 7, 4: 117} {0: 1, 1: 1, 2: 0, 3: 0, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!