ID: 1132932239_1132932249

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1132932239 1132932249
Species Human (GRCh38) Human (GRCh38)
Location 16:2464576-2464598 16:2464629-2464651
Sequence CCCTGGCTGGCCCTGTGCCGGGC ACGTGTCCTTACCATCCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 421} {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!