ID: 1132934574_1132934586

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132934574 1132934586
Species Human (GRCh38) Human (GRCh38)
Location 16:2474175-2474197 16:2474226-2474248
Sequence CCAAGGAGTCCTTGCTCGCGTCG GTCCCCGCCGGCAGCTCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21} {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!