ID: 1132942798_1132942810

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132942798 1132942810
Species Human (GRCh38) Human (GRCh38)
Location 16:2516530-2516552 16:2516562-2516584
Sequence CCAACCTCCAGCTGTGTCCCCAG CTTGGCCTGCCTGGCACTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 475} {0: 1, 1: 0, 2: 6, 3: 49, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!