ID: 1132942878_1132942887

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1132942878 1132942887
Species Human (GRCh38) Human (GRCh38)
Location 16:2516976-2516998 16:2517011-2517033
Sequence CCTGCTGCCCTCTGTAGAAAAGG TCCTGCCTCTGGTGGACTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 177} {0: 1, 1: 0, 2: 1, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!