ID: 1132945327_1132945340

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1132945327 1132945340
Species Human (GRCh38) Human (GRCh38)
Location 16:2529012-2529034 16:2529046-2529068
Sequence CCCTGGAGGCTGCATCCCTGCAC GCTGGGGCTGGAGAAGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 375} {0: 1, 1: 0, 2: 6, 3: 71, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!