ID: 1132973175_1132973185

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132973175 1132973185
Species Human (GRCh38) Human (GRCh38)
Location 16:2698772-2698794 16:2698805-2698827
Sequence CCTGCTGGAGCTCCCTTGGTGCC CTGGAGGGGCTCCTTGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182} {0: 1, 1: 0, 2: 1, 3: 23, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!