ID: 1132985605_1132985610

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1132985605 1132985610
Species Human (GRCh38) Human (GRCh38)
Location 16:2765649-2765671 16:2765681-2765703
Sequence CCGCTCTGCCTCATCCTCACCAG CTAGAACTCCCCCAAGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 122, 4: 1183} {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!