ID: 1132995057_1132995065

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1132995057 1132995065
Species Human (GRCh38) Human (GRCh38)
Location 16:2818421-2818443 16:2818446-2818468
Sequence CCCCTGGAGGCCTTGGCTCAATG AGGCTCCTTGGGACAGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 156} {0: 1, 1: 0, 2: 2, 3: 28, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!